Sequence ID | >WENV170643757 |
Genome ID | JMBV01000498 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 8001 |
End posion on genome | 7927 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
ccatcatggg |
tRNA gene sequence |
GGGGATATGGCGCAGCTGGGAGCGCGTCTGCTTCGCATGCAGAAGGCCGGGGTTCGAATC |
Downstream region at tRNA end position |
tgagcgaaag |
Secondary structure (Cloverleaf model) | >WENV170643757 Ala CGC g ACCA tgagcgaaag G - C G - C G + T G - C A - T T - A A - T T A T C C C C C A C G A G | | | | G T C G C G C G G G G C G | | | | T T G G C G C G A G AGGC T - A C - G T - A G - C C - G T T T A C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |