Sequence ID | >WENV170643758 |
Genome ID | JMBV01000505 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 6014 |
End posion on genome | 5941 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
tcccttttaa |
tRNA gene sequence |
GCCACCTTAGCTCAGTCGGTAGAGCAGCGCATTCGTAATGCGCGGGTCGTGGGTTCGAGT |
Downstream region at tRNA end position |
caaaatcccc |
Secondary structure (Cloverleaf model) | >WENV170643758 Thr CGT a TCat caaaatcccc G - C C - G C - G A - T C - G C - G T + G T G T T A C C C A T G A A + | | | | G C C T C G G T G G G C G | | | | T T G G A G C T A A GGGTC G - C C - G G - C C - G A - T T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |