Sequence ID | >WENV170643761 |
Genome ID | JMBV01000514 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 10879 |
End posion on genome | 10804 |
Amino Acid | Arg |
Anticodon | TCG |
Upstream region at tRNA start position |
ttgtgaacaT |
tRNA gene sequence |
GCACCTGTAGCTCAATTGGATAGAGCACCTGACTTCGGATCAGGGCGCTGGGGGTTCGAG |
Downstream region at tRNA end position |
ttttgtttca |
Secondary structure (Cloverleaf model) | >WENV170643761 Arg TCG T ATta ttttgtttca G - C C - G A - T C - G C - G T - A G - C T G T T C T C C A T A A A + | + | | G T C T C G G G G G G C G | | | | T T G G A G C A T A A GCGCT C - G C - G T - A G - C A - T C A T G T C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |