Sequence ID | >WENV170643768 |
Genome ID | JMBV01000643 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 7605 |
End posion on genome | 7690 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
taaataaatc |
tRNA gene sequence |
GCCCGAGTGGCGGAATTGGTAGACGCGTTGGTCTCAAAAACCAATGAGATTTTCTCGTGC |
Downstream region at tRNA end position |
gataaaaccc |
Secondary structure (Cloverleaf model) | >WENV170643768 Leu CAA c ACCA gataaaaccc G + T C - G C - G C - G G - C A - T G - C T T T C G G C C A T A A G | | | | | G T G G C G G C C G G C G | | | T T G A C G C T A G G TGAGATTTTCTCGT T - A T - A G - C G - C T - A C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |