Sequence ID | >WENV170643770 |
Genome ID | JMBV01000653 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 7391 |
End posion on genome | 7317 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
tacaaccttg |
tRNA gene sequence |
GCCCCCATAGTTCAAGGGATAGAACGGAAGTTTCCTAAACTTTAAATCCAGGTTCGAGTC |
Downstream region at tRNA end position |
ccaaaacctc |
Secondary structure (Cloverleaf model) | >WENV170643770 Arg CCT g GCTA ccaaaacctc G G C - G C - G C - G C - G C - G A - T T G T G G T C C A G A A A | | | | | G G C T T G C C A G G C G | | | | T T A G A A C T A G AAAT G + T A - T A - T G - C T - A T A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |