Sequence ID | >WENV170643777 |
Genome ID | JMBV01000766 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 414 |
End posion on genome | 344 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
gcctgcgggt |
tRNA gene sequence |
GCGGGTGTAGCTCAGTGGTAGAGCACTGGCTTCCCAAGCCAGCTGCGAGGGTTCGATTCC |
Downstream region at tRNA end position |
agaaattcat |
Secondary structure (Cloverleaf model) | >WENV170643777 Gly CCC t Ttta agaaattcat G - C C - G G - C G - C G - C T - A G - C T T T T T C C C A G A A + | | | | G T C T C G G A G G G C G | | | | T T G G A G C T A A CTGC C - G T - A G - C G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |