Sequence ID | >WENV170643783 |
Genome ID | JMBV01000827 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 6140 |
End posion on genome | 6213 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
agatcttccc |
tRNA gene sequence |
GGGCGGATAGCTCAGTTGGTTAGAGCGTTTCTTTTACACAGAAGAGGTCGCAGGTTCGAG |
Downstream region at tRNA end position |
tttttctctg |
Secondary structure (Cloverleaf model) | >WENV170643783 Val TAC c Attt tttttctctg G - C G - C G - C C - G G + T G - C A - T T G T T G T C C A T G A A + | | | | G T C T C G G C A G G C G | | | | T T G G A G C T T A G AGGTC T + G T - A T - A C - G T - A T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |