Sequence ID | >WENV170643791 |
Genome ID | JMBV01000959 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 1288 |
End posion on genome | 1373 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
cttgctctgt |
tRNA gene sequence |
GGAGGGATGGCCGAGCGGTTGAAGGCGCCTGTCTTGAAAACAGGTTTAGGGAAACCTAAC |
Downstream region at tRNA end position |
aacagacctt |
Secondary structure (Cloverleaf model) | >WENV170643791 Ser TGA t GCtg aacagacctt G - C G - C A - T G - C G - C G + T A - T T A T C A C C C A C G A G | | | | | G G G C C G G T G G G C G | | | T T T A G G C T G A G TTTAGGGAAACCTAAC C - G C - G T - A G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |