Sequence ID | >WENV170643796 |
Genome ID | JMBV01000977 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 473 |
End posion on genome | 548 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
taattctttg |
tRNA gene sequence |
CGGGATGTAGCGCAGCCCGGCTAGCGCGCCACGTTCGGGACGTGGAGGCCGCGAGTTCGA |
Downstream region at tRNA end position |
taatagaggc |
Secondary structure (Cloverleaf model) | >WENV170643796 Pro CGG g ACag taatagaggc C - G G - C G - C G - C A - T T - A G - C T A T C G C T C A C C G A A | | | | | G C C G C G G C G A G C G | | | | T T G G C G C C T A G AGGCC C - G C - G A - T C - G G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |