Sequence ID | >WENV170643797 |
Genome ID | JMBV01000977 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 1828 |
End posion on genome | 1901 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
attttgatac |
tRNA gene sequence |
GGTACCATGGCCGAGTGGTTAGGCAACGGTCTGCAAAACCGTGTACAGCGGTTCGACTCC |
Downstream region at tRNA end position |
ctttaaaacc |
Secondary structure (Cloverleaf model) | >WENV170643797 Cys GCA c TCTA ctttaaaacc G - C G - C T - A A - T C - G C - G A - T T C T T C G C C A G A G | | | | | G T G C C G A G C G G C G | | | T T G A G G C T T A GTAC A - T C - G G - C G - C T - A C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |