Sequence ID | >WENV170643802 |
Genome ID | JMBV01001033 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 1838 |
End posion on genome | 1910 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
ttttactcac |
tRNA gene sequence |
GCCGAGTTAGCTCAGTTGGTAGAGCATTCGACTGAAAATCGAAGGGTCCACAGTTCAAGT |
Downstream region at tRNA end position |
acaacctctg |
Secondary structure (Cloverleaf model) | >WENV170643802 Phe GAA c Ataa acaacctctg G - C C - G C - G G - C A - T G - C T - A T G T G T G T C A T G A A | | | | | A T C T C G C A C A G C G | | | | T T G G A G C T A A GGGTC T - A T - A C - G G - C A - T C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |