Sequence ID | >WENV170643803 |
Genome ID | JMBV01001087 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 582 |
End posion on genome | 505 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
agctgaagaC |
tRNA gene sequence |
GCCCCAGTGGCTCAATGGATAGAGCAAGGCACTCCTAACGCCTAGATTGGGGGGGGTTCG |
Downstream region at tRNA end position |
tgaaaaaaac |
Secondary structure (Cloverleaf model) | >WENV170643803 Arg CCT C GGta tgaaaaaaac G G C - G C - G C - G C - G A - T G - C T T T C T C C C A T A A G | + | | | G G C T C G G G G G G C G | | | | T T A G A G C T A A AGATTGGG A - T G - C G - C C - G A C C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |