Sequence ID | >WENV170643805 |
Genome ID | JMBV01001141 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 653 |
End posion on genome | 745 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
aaatatattg |
tRNA gene sequence |
GGAGAGATGCTGGAGTCCGGCTGAACAGGCACGACTGGAAATCGTGTAGGGGTGATGAGC |
Downstream region at tRNA end position |
ttttaaactt |
Secondary structure (Cloverleaf model) | >WENV170643805 Ser GGA g GCCA ttttaaactt G - C G - C A - T G - C A - T G - C A - T T A T C T C C C A C T G A G | | | | | G C G G T C G A G G G C G | | | T T G A C A G C T G A G TAGGGGTGATGAGCCCCTC C - G A - T C - G G - C A - T C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |