Sequence ID | >WENV170643810 |
Genome ID | JMBV01001290 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 2010 |
End posion on genome | 2093 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
ttgtttcggg |
tRNA gene sequence |
GGGGCGGTGGCGGAATAGGCAGACGCAACGGACTTAAAATCCGTCGGTGGTGACACTGTG |
Downstream region at tRNA end position |
agagaccttc |
Secondary structure (Cloverleaf model) | >WENV170643810 Leu TAA g Ataa agagaccttc G + T G - C G - C G - C C - G G - C G - C C C T C A C C C A T A A G | | | | | G A G G C G G T G G G C G | | | T T G A C G C C A G A CGGTGGTGACACTGT A - T C - G G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |