Sequence ID | >WENV170643814 |
Genome ID | JMBV01001476 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 3723 |
End posion on genome | 3646 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
cacattcctT |
tRNA gene sequence |
GGGCGGTTAGCTCAGTTGGTTAGAGCGTTGCGTTGACATCGCAAAGGTCGTAGGTTCGAG |
Downstream region at tRNA end position |
aaaacccccc |
Secondary structure (Cloverleaf model) | >WENV170643814 Val GAC T ATCA aaaacccccc G - C G - C G - C C A G - C G - C T - A T G T T A T C C A T G A A + | | | | G T C T C G G T A G G C G | | | | T T G G A G C T T A G AGGTC T - A T - A G - C C - G G - C T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |