Sequence ID | >WENV170643818 |
Genome ID | JMBV01001501 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 3608 |
End posion on genome | 3530 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
aaataaattt |
tRNA gene sequence |
GTACCTATAGCTCAACTGGATAGAGTGCCTGACTACGAATCAGGAGGCTGGGGGGGTTCG |
Downstream region at tRNA end position |
agttaaatcc |
Secondary structure (Cloverleaf model) | >WENV170643818 Arg ACG t ACCA agttaaatcc G - C T - A A - T C - G C - G T - A A - T T G T C T C C C A C A A A | + | | | G T C T C G G G G G G C G | | | + T T G G A G T A T A G AGGCTGG C - G C - G T - A G - C A - T C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |