Sequence ID | >WENV170643819 |
Genome ID | JMBV01001505 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 382 |
End posion on genome | 308 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
gcacttgccT |
tRNA gene sequence |
TCCCTGGTAGCTCAATCGGCAGAGCGGGCGGCTGTTAACCGCTAGGTTAGAGGTTCGAGT |
Downstream region at tRNA end position |
ctgagaatga |
Secondary structure (Cloverleaf model) | >WENV170643819 Asn GTT T GGag ctgagaatga T + G C - G C - G C - G T + G G - C G - C T G T T C T C C A T A A A | | | | | G C C T C G A G A G G C G | | | | T T G G A G C C A G AGGTT G + T G - C C - G G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |