Sequence ID | >WENV170643820 |
Genome ID | JMBV01001505 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 238 |
End posion on genome | 164 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
ccgcacgaaT |
tRNA gene sequence |
GGTCCTGTAGCTCAATTGGCAGAGCAAGCGCCTCTTAAGCGTTAGGTTCTCGGTTCGAGT |
Downstream region at tRNA end position |
ctttatttaa |
Secondary structure (Cloverleaf model) | >WENV170643820 Lys CTT T ATtt ctttatttaa G - C G + T T - A C - G C - G T - A G - C T G T G A G C C A T A A A | | | | | G T C T C G C T C G G C G | | | | T T G G A G C C A A AGGTT A - T G + T C - G G - C C - G C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |