Sequence ID | >WENV170643825 |
Genome ID | JMBV01001533 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 3843 |
End posion on genome | 3772 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
cttattttta |
tRNA gene sequence |
GGCGACGTGGCCAAGTGGTAAGGCAGGAGTCTGCAAAACTCTCATCATGGGTTCAATTCC |
Downstream region at tRNA end position |
tttctttaac |
Secondary structure (Cloverleaf model) | >WENV170643825 Cys GCA a TCtc tttctttaac G - C G - C C - G G - C A - T C - G G - C T T T T A C C C A G A G | | | | | A T A C C G A T G G G C G | | | T T G A G G C T A A CATC G + T G - C A - T G - C T - A C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |