Sequence ID | >WENV170643826 |
Genome ID | JMBV01001564 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 2201 |
End posion on genome | 2130 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
attcgttatc |
tRNA gene sequence |
GGCGAGATAGCTCAACGGTGGAGCAGTGGACTCATAAGCCATTGGTTCTGGGTTCAAATC |
Downstream region at tRNA end position |
ttttatttaa |
Secondary structure (Cloverleaf model) | >WENV170643826 Met CAT c Attt ttttatttaa G - C G - C C - G G - C A - T G - C A - T T A T G A C C C A A A A | | | | | A C C T C G C T G G G C G | | | | T T G G A G C T G A TGGTT G + T T - A G - C G - C A G C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |