Sequence ID | >WENV170643828 |
Genome ID | JMBV01001581 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 3175 |
End posion on genome | 3100 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
taacacacac |
tRNA gene sequence |
ACGGGTGTAGCTCAATTGGTAGAGCGACGGTCTCCAAAACCGTAGGCTGTGGGTTCGATT |
Downstream region at tRNA end position |
tcaaatgaaa |
Secondary structure (Cloverleaf model) | >WENV170643828 Trp CCA c GCTA tcaaatgaaa A - T C - G G - C G - C G - C T T G - C T T T C A T C C A T A A A | | + | | G T C T C G G T G G G C G | | | | T T G G A G C T A G AGGCT A - T C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |