Sequence ID | >WENV170643835 |
Genome ID | JMBV01001692 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 3328 |
End posion on genome | 3401 |
Amino Acid | Arg |
Anticodon | GCG |
Upstream region at tRNA start position |
tgcgtaaaag |
tRNA gene sequence |
GTCCTCGTAGCTTAATGGATAGAGCACCTGCTTGCGGAGCAGACGGTTGCGCGTTCGACT |
Downstream region at tRNA end position |
tttttctttt |
Secondary structure (Cloverleaf model) | >WENV170643835 Arg GCG g ACtt tttttctttt G - C T - A C - G C - G T - A C - G G - C T C T C G C G C A T A A A | | | | | G G T T C G G C G C G C G + | | | T T A G A G C T A A CGGTT C A C - G T - A G - C C - G T A T G G C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |