Sequence ID | >WENV170643836 |
Genome ID | JMBV01001707 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 2898 |
End posion on genome | 2969 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
gcctgcaggg |
tRNA gene sequence |
GGGCCTGTAGCTCAATGGCGGAGCAGGCGGCTCATAACCGCTTGGTTGATGGTTCGAATC |
Downstream region at tRNA end position |
tcttttattt |
Secondary structure (Cloverleaf model) | >WENV170643836 Met CAT g Attt tcttttattt G - C G - C G - C C - G C - G T + G G - C T A T C T A C C A A A A | | | | | G T C T C G G A T G G C G | | | | T T G G A G C C G A TGGTT G + T G - C C - G G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |