Sequence ID | >WENV170643844 |
Genome ID | JMBV01002204 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 2378 |
End posion on genome | 2450 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
cattgctgtG |
tRNA gene sequence |
GGGGGGCTCGTCTAATGGCAGGACAGCGGACTCTGAATCCGTATGTATTGGTTCGACTCC |
Downstream region at tRNA end position |
tctctgaccc |
Secondary structure (Cloverleaf model) | >WENV170643844 Gln CTG G CAgc tctctgaccc G - C G - C G - C G - C G - C G - C C - G T C T T G A C C A A A C | + | | | G T T C T G A T T G G C G + | | | T T G G G A C C A A ATGT G + T C - G G - C G - C A - T C A T A C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |