Sequence ID | >WENV170643846 |
Genome ID | JMBV01002416 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 1080 |
End posion on genome | 1155 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
tagactaggt |
tRNA gene sequence |
GGGTCATTAGCTCAGGTGGTAGAGCACCGGACTTTTAATCCGGGTGTCGTGGGTTCGAGT |
Downstream region at tRNA end position |
gttatttttg |
Secondary structure (Cloverleaf model) | >WENV170643846 Lys TTT t ACCA gttatttttg G - C G - C G - C T - A C - G A - T T - A T G T C G C C C A G G A A | + | | | G T C T C G G T G G G C G | | | | T T G G A G C T A A GTGTC C - G C - G G - C G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |