Sequence ID | >WENV170643849 |
Genome ID | JMBV01002530 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 6 |
End posion on genome | 81 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
nnnnntttgc |
tRNA gene sequence |
GCTCCCATGGTCTAGTGGCCTAGGACATCGCCCTTTCAAGGCGGTAACACGGGTTCGAAT |
Downstream region at tRNA end position |
ttattatgcc |
Secondary structure (Cloverleaf model) | >WENV170643849 Glu TTC c GCCA ttattatgcc G - C C - G T - A C - G C - G C - G A - T T A T T G C C C A T G A G | | | | | G G T C T G A C G G G C G + | | | T T C G G A C C T A A TAAC T + G C - G G - C C - G C - G C A T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |