Sequence ID | >WENV170643853 |
Genome ID | JMBV01002847 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 455 |
End posion on genome | 536 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
cttttcactc |
tRNA gene sequence |
GCCGAAGTGGCGGAATAGGCAGACGCGCGCGACTCAAAATCGCGTACCTACGGGTATGTG |
Downstream region at tRNA end position |
cacgcaagca |
Secondary structure (Cloverleaf model) | >WENV170643853 Leu CAA c Attc cacgcaagca G - C C - G C - G G - C A - T A - T G - C T T T C A C C C A T A A G | | | | | G A G G C G G T G G G C G | | | T T G A C G C C A G G TACCTACGGGTAT C - G G - C C - G G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |