Sequence ID | >WENV170643855 |
Genome ID | JMBV01002918 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 180 |
End posion on genome | 256 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
ttagctgtaa |
tRNA gene sequence |
CGGGGCGTGGCGCAGTTTGGTAGCGCGCTTGGTTCGGGACCAAGAGGTCGCAGGTTCAAA |
Downstream region at tRNA end position |
ttgataataa |
Secondary structure (Cloverleaf model) | >WENV170643855 Pro CGG a ACCA ttgataataa C - G G - C G - C G + T G - C C - G G - C T A T T G T C C A T G A G + | | | | A T C G C G G C A G G C T | | | | T T G G C G C G T A G AGGTC C - G T - A T - A G - C G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |