Sequence ID | >WENV170643856 |
Genome ID | JMBV01002927 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 144 |
End posion on genome | 69 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
taaaccttat |
tRNA gene sequence |
GGTCTCGTGGCTCAATGGGTAGAGCGGTGCGCTGTTAACGCAAAGGTTTTAGGTTCAAAT |
Downstream region at tRNA end position |
tgaaacagga |
Secondary structure (Cloverleaf model) | >WENV170643856 Asn GTT t GCCA tgaaacagga G - C G - C T - A C - G T - A C - G G - C T A T T A T C C A T A A G | | | | A G C T C G T T A G G C G | | | | T T G G A G C T A G AGGTT G A T - A G - C C - G G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |