Sequence ID | >WENV170643857 |
Genome ID | JMBV01002979 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 1875 |
End posion on genome | 1948 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
tttcagacaa |
tRNA gene sequence |
GGTACCATAGCTCAGTCGGTAGAGCAACGGACTGAAAATCCGTGTGTCCCTGGTTCGATT |
Downstream region at tRNA end position |
ttccnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170643857 Phe GAA a ACtt ttccnnnnnn G - C G - C T - A A - T C - G C - G A - T T T T G G A C C A T G A A | | | | | G C C T C G C C T G G C G | | | | T T G G A G C T A A GTGTC A - T C - G G - C G - C A - T C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |