Sequence ID | >WENV170643859 |
Genome ID | JMBV01003012 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 241 |
End posion on genome | 312 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
ttgtttagta |
tRNA gene sequence |
TGCCCGATGGTGTAATGGCAGCACAAGAGATTTTGGTTCTCTTGGTCTAGGTTCGAATCC |
Downstream region at tRNA end position |
caaacctatt |
Secondary structure (Cloverleaf model) | >WENV170643859 Gln TTG a ACag caaacctatt T - A G - C C - G C - G C - G G - C A - T T A T G G T C C A A A G | + | | | G T T G T G C T A G G C G + | | | T T G G C A C C A A TGGT A - T G - C A - T G - C A - T T T T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |