Sequence ID | >WENV170643860 |
Genome ID | JMBV01003079 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 433 |
End posion on genome | 508 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
aatctcattt |
tRNA gene sequence |
TGCCCGATGGTGTAATTGGCAACACGTCTGACTCTGGATCAGAAAAGTCCAGGTTCGAAC |
Downstream region at tRNA end position |
agtaaatagg |
Secondary structure (Cloverleaf model) | >WENV170643860 Gln CTG t ACAA agtaaatagg T - A G - C C - G C - G C - G G - C A - T C A T G G T C C A T A A G | | | | | G T T G T G C C A G G C G | | | | T T G A C A C C A G AAAGT T - A C - G T - A G - C A - T C A T G C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |