Sequence ID | >WENV170643863 |
Genome ID | JMBV01003282 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 1454 |
End posion on genome | 1529 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
ttaatagatt |
tRNA gene sequence |
GCCCAGATAGCTCAGTAGGTAGAGCAAGGGACTGAAAATCCCTGTGTCGGCAGTTCGATT |
Downstream region at tRNA end position |
gttcattcgc |
Secondary structure (Cloverleaf model) | >WENV170643863 Phe GAA t ACCA gttcattcgc G - C C - G C - G C - G A - T G - C A - T T T T C T G T C A T G A A | + | | | G A C T C G G G C A G C G | | | | T T G G A G C T A A GTGTC A - T G - C G - C G - C A - T C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |