Sequence ID | >WENV170643867 |
Genome ID | JMBV01004018 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 81 |
End posion on genome | 156 |
Amino Acid | Gly |
Anticodon | ACC |
Upstream region at tRNA start position |
ttttcgcagg |
tRNA gene sequence |
GGGGGAGTAGCTCAATTGGTAGAGCATCGGTCTACCAAACCGAGGGCTGCGGGTTCGAGT |
Downstream region at tRNA end position |
ttatttcaaa |
Secondary structure (Cloverleaf model) | >WENV170643867 Gly ACC g GCCA ttatttcaaa G + T G - C G - C G - C G - C A - T G - C T G T T G T C C A T A A A + | + | | G T C T C G G C G G G C G | | | | T T G G A G C T A A GGGCT T - A C - G G - C G - C T - A C A T A A C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |