Sequence ID | >WENV170643869 |
Genome ID | JMBV01004201 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 164 |
End posion on genome | 241 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
ttaatactgT |
tRNA gene sequence |
TGGGGTGTAGCCAAGCTGGTAAGGCAACGGACTTTGACTCCGTGATTCGTAGGTTCGAGT |
Downstream region at tRNA end position |
Attttatttt |
Secondary structure (Cloverleaf model) | >WENV170643869 Gln TTG T AGCC Attttatttt T C G - C G - C G - C G - C T - A G - C T G T C G T C C A C G A A | + | | | G T A C C G G T A G G C G | | | T T G A G G C T A A GATTC A - T C - G G - C G - C A - T C C T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |