Sequence ID | >WENV170643871 |
Genome ID | JMBV01004262 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 275 |
End posion on genome | 203 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
gatggagtac |
tRNA gene sequence |
GGGCCTGTAGCGCAGTTGGGAGCGCGCTTCAATCGCACTGAAGAGGTCGAGGGTTCGAAT |
Downstream region at tRNA end position |
tatgaacagg |
Secondary structure (Cloverleaf model) | >WENV170643871 Ala CGC c Attg tatgaacagg G - C G - C G + T C - G C - G T - A G - C T A T C T C C C A T G A A | | | | | G T C G C G G A G G G C G | | | | T T G G C G C G A G AGGTC C - G T - A T - A C - G A - T A C T A C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |