Sequence ID | >WENV170643872 |
Genome ID | JMBV01004286 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 321 |
End posion on genome | 228 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
gcggattaat |
tRNA gene sequence |
GGAGAGATGACCGAGTTGGTTGAAGGTGCACGCCTGGAAAGCGTGTGTAGGGGGGGAAAC |
Downstream region at tRNA end position |
taaataaagg |
Secondary structure (Cloverleaf model) | >WENV170643872 Ser GGA t GCCA taaataaagg G - C G - C A - T G - C A - T G - C A - T T A T C T C C C A T T G A G | | | | | G G G C C A G A G G G C G | | | T T T A G G T T G A G TGTAGGGGGGGAAACTCTACC C - G A - T C - G G - C C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |