Sequence ID | >WENV170643873 |
Genome ID | JMBV01004328 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 787 |
End posion on genome | 713 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
gactctgaaa |
tRNA gene sequence |
GGGCCTTTAGCTCAGCTGGTTAGAGCGCGCCTCTGATAAGGGCGAGGTCTCAGGTTCGAA |
Downstream region at tRNA end position |
ttcagataac |
Secondary structure (Cloverleaf model) | >WENV170643873 Ile GAT a ACtt ttcagataac G - C G - C G - C C - G C - G T - A T - A T A T A G C C C A C G A A | | | | G T C T C G T C A G G C G | | | | T T G G A G C T T A G AGGTC C - G G - C C - G C - G T + G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |