Sequence ID | >WENV170643877 |
Genome ID | JMBV01004393 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 97 |
End posion on genome | 20 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
tcaggatccg |
tRNA gene sequence |
GCCGGCATAGCTCAATTGGCAGAGCAGCTGAATCGTAATCAGCATGTTGGGGGGGTTCAA |
Downstream region at tRNA end position |
ccatgcccgg |
Secondary structure (Cloverleaf model) | >WENV170643877 Thr CGT g TCCA ccatgcccgg G - C C - G C - G G - C G - C C - G A - T T G T T C T C C A T A A A + | + | | A T C T C G G G G G G C G | | | | T T G G A G C C A A ATGTTGG G - C C - G T - A G - C A - T A A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |