Sequence ID | >WENV170643880 |
Genome ID | JMBV01004706 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 1371 |
End posion on genome | 1287 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
atcataaaat |
tRNA gene sequence |
ACAGGTGTGGCGGAATAGGTAGACGCGTTAGTTTTAGAAACTAATTTCTATTGAAGTGAA |
Downstream region at tRNA end position |
taaaaattgt |
Secondary structure (Cloverleaf model) | >WENV170643880 Leu TAG t ACTA taaaaattgt A - T C - G A - T G - C G - C T + G G - C A A T T T T C C A T A A G + | | | | A A G G C G G A A G G C G | | | T T G A C G C T A G G TTTCTATTGAAGT T - A T - A A - T G - C T - A T A T A T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |