Sequence ID | >WENV170643885 |
Genome ID | JMBV01005092 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 963 |
End posion on genome | 1038 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
acgacagtaa |
tRNA gene sequence |
GCCGACGTAGCTCAATTGGCAGAGCAGCTGATTTGTAATCAGCAGGTTACCGGTTCAAGT |
Downstream region at tRNA end position |
gctatatgcc |
Secondary structure (Cloverleaf model) | >WENV170643885 Thr TGT a TCCA gctatatgcc G - C C - G C - G G - C A - T C - G G - C T G T T G G C C A T A A A | | | | | A T C T C G A C C G G C G | | | | T T G G A G C C A A AGGTT G - C C - G T - A G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |