Sequence ID | >WENV170643887 |
Genome ID | JMBV01005155 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 328 |
End posion on genome | 402 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
aaaatagtgc |
tRNA gene sequence |
GGGGGGGTGGAGCAGAGGTAGCTCGTTGGGCTCATAACCCAAAGGCCGGAGGTTCGAATC |
Downstream region at tRNA end position |
acttaaaaat |
Secondary structure (Cloverleaf model) | >WENV170643887 Met CAT c TACA acttaaaaat G - C G G G - C G - C G - C G - C G - C T A T C T T C C A G A G | + | | | G A C G A G G G A G G C G | | | | T T G G C T C T A G AGGCC T - A T - A G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |