Sequence ID | >WENV170643888 |
Genome ID | JMBV01005172 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 1298 |
End posion on genome | 1223 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
gattaggttt |
tRNA gene sequence |
GCACCTTTAGCTCAGTCGGCAGAGCAATTGACTCTTAATCAATGGGCCCAGGGTTCGAAT |
Downstream region at tRNA end position |
gttaaataca |
Secondary structure (Cloverleaf model) | >WENV170643888 Lys CTT t ACCA gttaaataca G - C C - G A - T C - G C - G T - A T - A T A T G T C C C A T G A A | | | | | G C C T C G C A G G G C G | | | | T T G G A G C C A A GGGCC A - T T - A T - A G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |