Sequence ID | >WENV170643889 |
Genome ID | JMBV01005306 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 159 |
End posion on genome | 87 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
acatttttat |
tRNA gene sequence |
TCCGCAATAGCTCAGTCGGTAGAGCACGTGACTGTTAATCACGCTGTCGCAGGTTCGAGT |
Downstream region at tRNA end position |
ttttttaata |
Secondary structure (Cloverleaf model) | >WENV170643889 Asn GTT t Tgtt ttttttaata T - A C - G C - G G - C C - G A - T A - T T G T C G T C C A T G A A | | | | | G C C T C G G C A G G C G | | | | T T G G A G C T A A CTGTC C - G G - C T - A G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |