Sequence ID | >WENV170643890 |
Genome ID | JMBV01005431 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 389 |
End posion on genome | 485 |
Amino Acid | SeC(p) |
Anticodon | TCA |
Upstream region at tRNA start position |
tgttgccacg |
tRNA gene sequence |
gGGGGGGTAGTTGGCGGTCTGGTGACGCTCATGGACTTCAAATCCAGTGGTGGGCGCGAT |
Downstream region at tRNA end position |
aaaaaattag |
Secondary structure (Cloverleaf model) | >WENV170643890 SeC(p) TCA g GCCA aaaaaattag g - C G - C G - C G + T G - C G A G + T T C T T A T A C C C A T G G C G + | | | | G C G G T T G T G G G C T | T T G C G C T G T G A C TGGTGGGCGCGATCCGTCCACG A G T - A G - C G - C A - T C A T A T C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |