Sequence ID | >WENV170643893 |
Genome ID | JMBV01005559 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 1200 |
End posion on genome | 1112 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
agttattagt |
tRNA gene sequence |
GCCCGGGTGGCGGAACTGGCAGACGCGCACGTTTGAGGGGCGTGTGGGTAACCCCCCCCA |
Downstream region at tRNA end position |
ttttttttgc |
Secondary structure (Cloverleaf model) | >WENV170643893 Leu GAG t ACCA ttttttttgc G - C C - G C - G C - G G - C G - C G - C T G T T G C T C A C A A G | | | | | A T G G C G A C G A G C G | | | T T G A C G C C A G G TGGGTAACCCCCCCCAT C - G A - T C - G G - C T + G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |