Sequence ID | >WENV170643895 |
Genome ID | JMBV01005836 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 191 |
End posion on genome | 275 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
ttaaaattac |
tRNA gene sequence |
GCGGGAGTGGCGGTAATTGGCAGACGCGCTGGATTTAGGTTCCAGTGGGAAACCGTGGGG |
Downstream region at tRNA end position |
aatctaaaga |
Secondary structure (Cloverleaf model) | >WENV170643895 Leu TAG c ACCA aatctaaaga G - C C - G G - C G - C G - C A - T G - C T A T T T C C C A T A A T G + + | | | A T G G C G G G G G G C G | | | T T G A C G C C A G G TGGGAAACCGTG C - G T - A G - C G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |