Sequence ID | >WENV170643896 |
Genome ID | JMBV01006046 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 92 |
End posion on genome | 166 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
ggaagcgcaa |
tRNA gene sequence |
AGGTCAGTGGCTCAATTGGCAGAGCACCGCTCTCCAAAAGCGGGGGGGTTGAGGGTTCGA |
Downstream region at tRNA end position |
aagtcaatca |
Secondary structure (Cloverleaf model) | >WENV170643896 Trp CCA a Gttg aagtcaatca A - T G - C G - C T - A C - G A - T G - C T G T C T T C C A T A A G | | + | | G T C T C G G A G G G C G | | | | T T G G A G C C A A GGGGGTT C - G C - G G - C C - G T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |