Sequence ID | >WENV170643897 |
Genome ID | JMBV01006224 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 744 |
End posion on genome | 820 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
taattagttt |
tRNA gene sequence |
GTGCCCATAGCTCAGCTGGATAGAGCAACGGCCTTCTAAGCCGTGTGTCCGGGGTTCGAA |
Downstream region at tRNA end position |
tggtggttgt |
Secondary structure (Cloverleaf model) | >WENV170643897 Arg TCT t GCCA tggtggttgt G - C T - A G - C C - G C - G C - G A - T T A T G T C C C A C G A A | + | | | G T C T C G C G G G G C G | | | | T T G G A G C A T A A GTGTC A - T C - G G - C G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |