Sequence ID | >WENV170643906 |
Genome ID | JMBV01006512 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 993 |
End posion on genome | 1068 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
ccaatagtgc |
tRNA gene sequence |
GGAGGCGTAGTGTAGCGGTTAACATGCCTGCCTGTCACGCAGGAGATCGTGGGTTCGAAT |
Downstream region at tRNA end position |
attctataac |
Secondary structure (Cloverleaf model) | >WENV170643906 Asp GTC c GCCA attctataac G - C G - C A - T G - C G + T C - G G - C T A T T A C C C A C G A A + | | | | G G T G T G G T G G G C G | | | + T T T A C A T T A G AGATC C - G C - G T - A G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |